Home
cd ../playbooks
Academic ResearchBeginner

Scientific Jaspar Database

Query JASPAR for transcription factor binding site (TFBS) profiles (PWMs/PFMs). Search by TF name, species, or class; scan DNA sequences for TF binding sites; compare matrices; essential for regulatory genomics, motif analysis, and GWAS regulatory...

5 minutes
By K-Dense AISource
#scientific#claude-code#jaspar-database#bioinformatics#database#protein#genomics#writing

Your ChIP-seq peaks show enrichment but you need to know which transcription factors bind those regions. JASPAR provides curated position weight matrices for thousands of TF binding profiles — the standard resource for scanning DNA sequences, identifying regulatory motifs, and interpreting non-coding GWAS variants.

Who it's for: regulatory genomicists scanning DNA sequences for transcription factor binding motifs, epigenomics researchers interpreting ChIP-seq and ATAC-seq peaks with TF binding profiles, computational biologists building gene regulatory network models, human geneticists analyzing non-coding GWAS variants for regulatory disruption, systems biologists mapping transcription factor binding across promoters and enhancers

Example

"Scan our ATAC-seq peak sequences for enriched transcription factor binding motifs" → JASPAR workflow: TF binding profile retrieval by species and structural class, position weight matrix scanning across peak sequences, enrichment analysis comparing to background, motif comparison and clustering of co-occurring TFs, and a regulatory motif report with binding site locations and significance scores

CLAUDE.md Template

New here? 3-minute setup guide → | Already set up? Copy the template below.

# JASPAR Database

## Overview

JASPAR (https://jaspar.elixir.no/) is the gold-standard open-access database of curated, non-redundant transcription factor (TF) binding profiles stored as position frequency matrices (PFMs). JASPAR 2024 contains 1,210 non-redundant TF binding profiles for 164 eukaryotic species. Each profile is experimentally derived (ChIP-seq, SELEX, HT-SELEX, protein binding microarray, etc.) and rigorously validated.

**Key resources:**
- JASPAR portal: https://jaspar.elixir.no/
- REST API: https://jaspar.elixir.no/api/v1/
- API docs: https://jaspar.elixir.no/api/v1/docs/
- Python package: `jaspar` (via Biopython) or direct API

## When to Use This Skill

Use JASPAR when:

- **TF binding site prediction**: Scan a DNA sequence for potential binding sites of a TF
- **Regulatory variant interpretation**: Does a GWAS/eQTL variant disrupt a TF binding motif?
- **Promoter/enhancer analysis**: What TFs are predicted to bind to a regulatory element?
- **Gene regulatory network construction**: Link TFs to their target genes via motif scanning
- **TF family analysis**: Compare binding profiles across a TF family (e.g., all homeobox factors)
- **ChIP-seq analysis**: Find known TF motifs enriched in ChIP-seq peaks
- **ENCODE/ATAC-seq interpretation**: Match open chromatin regions to TF binding profiles

## Core Capabilities

### 1. JASPAR REST API

Base URL: `https://jaspar.elixir.no/api/v1/`

```python
import requests

BASE_URL = "https://jaspar.elixir.no/api/v1"

def jaspar_get(endpoint, params=None):
    url = f"{BASE_URL}/{endpoint}"
    response = requests.get(url, params=params, headers={"Accept": "application/json"})
    response.raise_for_status()
    return response.json()
```

### 2. Search for TF Profiles

```python
def search_jaspar(
    tf_name=None,
    species=None,
    collection="CORE",
    tf_class=None,
    tf_family=None,
    page=1,
    page_size=25
):
    """Search JASPAR for TF binding profiles."""
    params = {
        "collection": collection,
        "page": page,
        "page_size": page_size,
        "format": "json"
    }
    if tf_name:
        params["name"] = tf_name
    if species:
        params["species"] = species  # Use taxonomy ID or name, e.g., "9606" for human
    if tf_class:
        params["tf_class"] = tf_class
    if tf_family:
        params["tf_family"] = tf_family

    return jaspar_get("matrix", params)

# Examples:
# Search for human CTCF profile
ctcf = search_jaspar("CTCF", species="9606")
print(f"Found {ctcf['count']} CTCF profiles")

# Search for all homeobox TFs in human
hox_tfs = search_jaspar(tf_class="Homeodomain", species="9606")

# Search for a TF family
nfkb = search_jaspar(tf_family="NF-kappaB")
```

### 3. Fetch a Specific Matrix (PFM/PWM)

```python
def get_matrix(matrix_id):
    """Fetch a specific JASPAR matrix by ID (e.g., 'MA0139.1' for CTCF)."""
    return jaspar_get(f"matrix/{matrix_id}/")

# Example: Get CTCF matrix
ctcf_matrix = get_matrix("MA0139.1")

# Matrix structure:
# {
#   "matrix_id": "MA0139.1",
#   "name": "CTCF",
#   "collection": "CORE",
#   "tax_group": "vertebrates",
#   "pfm": { "A": [...], "C": [...], "G": [...], "T": [...] },
#   "consensus": "CCGCGNGGNGGCAG",
#   "length": 19,
#   "species": [{"tax_id": 9606, "name": "Homo sapiens"}],
#   "class": ["C2H2 zinc finger factors"],
#   "family": ["BEN domain factors"],
#   "type": "ChIP-seq",
#   "uniprot_ids": ["P49711"]
# }
```

### 4. Download PFM/PWM as Matrix

```python
import numpy as np

def get_pwm(matrix_id, pseudocount=0.8):
    """
    Fetch a PFM from JASPAR and convert to PWM (log-odds).
    Returns numpy array of shape (4, L) in order A, C, G, T.
    """
    matrix = get_matrix(matrix_id)
    pfm = matrix["pfm"]

    # Convert PFM to numpy
    pfm_array = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float)

    # Add pseudocount
    pfm_array += pseudocount

    # Normalize to get PPM
    ppm = pfm_array / pfm_array.sum(axis=0, keepdims=True)

    # Convert to PWM (log-odds relative to background 0.25)
    background = 0.25
    pwm = np.log2(ppm / background)

    return pwm, matrix["name"]

# Example
pwm, name = get_pwm("MA0139.1")  # CTCF
print(f"PWM for {name}: shape {pwm.shape}")
max_score = pwm.max(axis=0).sum()
print(f"Maximum possible score: {max_score:.2f} bits")
```

### 5. Scan a DNA Sequence for TF Binding Sites

```python
import numpy as np
from typing import List, Tuple

NUCLEOTIDE_MAP = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
                  'a': 0, 'c': 1, 'g': 2, 't': 3}

def scan_sequence(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8) -> List[dict]:
    """
    Scan a DNA sequence for TF binding sites using a PWM.

    Args:
        sequence: DNA sequence string
        pwm: PWM array (4 x L) in ACGT order
        threshold_pct: Fraction of max score to use as threshold (0-1)

    Returns:
        List of hits with position, score, and matched sequence
    """
    motif_len = pwm.shape[1]
    max_score = pwm.max(axis=0).sum()
    min_score = pwm.min(axis=0).sum()
    threshold = min_score + threshold_pct * (max_score - min_score)

    hits = []
    seq = sequence.upper()

    for i in range(len(seq) - motif_len + 1):
        subseq = seq[i:i + motif_len]
        # Skip if contains non-ACGT
        if any(c not in NUCLEOTIDE_MAP for c in subseq):
            continue

        score = sum(pwm[NUCLEOTIDE_MAP[c], j] for j, c in enumerate(subseq))

        if score >= threshold:
            relative_score = (score - min_score) / (max_score - min_score)
            hits.append({
                "position": i + 1,  # 1-based
                "score": score,
                "relative_score": relative_score,
                "sequence": subseq,
                "strand": "+"
            })

    return hits

# Example: Scan a promoter sequence for CTCF binding sites
promoter = "AGCCCGCGAGGNGGCAGTTGCCTGGAGCAGGATCAGCAGATC"
pwm, name = get_pwm("MA0139.1")
hits = scan_sequence(promoter, pwm, threshold_pct=0.75)
for hit in hits:
    print(f"  Position {hit['position']}: {hit['sequence']} (score: {hit['score']:.2f}, {hit['relative_score']:.0%})")
```

### 6. Scan Both Strands

```python
def reverse_complement(seq: str) -> str:
    complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'N': 'N'}
    return ''.join(complement.get(b, 'N') for b in reversed(seq.upper()))

def scan_both_strands(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8):
    """Scan forward and reverse complement strands."""
    fwd_hits = scan_sequence(sequence, pwm, threshold_pct)
    for h in fwd_hits:
        h["strand"] = "+"

    rev_seq = reverse_complement(sequence)
    rev_hits = scan_sequence(rev_seq, pwm, threshold_pct)
    seq_len = len(sequence)
    for h in rev_hits:
        h["strand"] = "-"
        h["position"] = seq_len - h["position"] - len(h["sequence"]) + 2  # Convert to fwd coords

    all_hits = fwd_hits + rev_hits
    return sorted(all_hits, key=lambda x: x["position"])
```

### 7. Variant Impact on TF Binding

```python
def variant_tfbs_impact(ref_seq: str, alt_seq: str, pwm: np.ndarray,
                          tf_name: str, threshold_pct: float = 0.7):
    """
    Assess impact of a SNP on TF binding by comparing ref vs alt sequences.
    Both sequences should be centered on the variant with flanking context.
    """
    ref_hits = scan_both_strands(ref_seq, pwm, threshold_pct)
    alt_hits = scan_both_strands(alt_seq, pwm, threshold_pct)

    max_ref = max((h["score"] for h in ref_hits), default=None)
    max_alt = max((h["score"] for h in alt_hits), default=None)

    result = {
        "tf": tf_name,
        "ref_max_score": max_ref,
        "alt_max_score": max_alt,
        "ref_has_site": len(ref_hits) > 0,
        "alt_has_site": len(alt_hits) > 0,
    }
    if max_ref and max_alt:
        result["score_change"] = max_alt - max_ref
        result["effect"] = "gained" if max_alt > max_ref else "disrupted"
    elif max_ref and not max_alt:
        result["effect"] = "disrupted"
    elif not max_ref and max_alt:
        result["effect"] = "gained"
    else:
        result["effect"] = "no_site"

    return result
```

## Query Workflows

### Workflow 1: Find All TF Binding Sites in a Promoter

```python
import requests, numpy as np

# 1. Get relevant TF matrices (e.g., all human TFs in CORE collection)
response = requests.get(
    "https://jaspar.elixir.no/api/v1/matrix/",
    params={"species": "9606", "collection": "CORE", "page_size": 500, "page": 1}
)
matrices = response.json()["results"]

# 2. For each matrix, compute PWM and scan promoter
promoter = "CCCGCCCGCCCGCCGCCCGCAGTTAATGAGCCCAGCGTGCC"  # Example

all_hits = []
for m in matrices[:10]:  # Limit for demo
    pwm_data = requests.get(f"https://jaspar.elixir.no/api/v1/matrix/{m['matrix_id']}/").json()
    pfm = pfm_data["pfm"]
    pfm_arr = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float) + 0.8
    ppm = pfm_arr / pfm_arr.sum(axis=0)
    pwm = np.log2(ppm / 0.25)

    hits = scan_sequence(promoter, pwm, threshold_pct=0.8)
    for h in hits:
        h["tf_name"] = m["name"]
        h["matrix_id"] = m["matrix_id"]
    all_hits.extend(hits)

print(f"Found {len(all_hits)} TF binding sites")
for h in sorted(all_hits, key=lambda x: -x["score"])[:5]:
    print(f"  {h['tf_name']} ({h['matrix_id']}): pos {h['position']}, score {h['score']:.2f}")
```

### Workflow 2: SNP Impact on TF Binding (Regulatory Variant Analysis)

1. Retrieve the genomic sequence flanking the SNP (±20 bp each side)
2. Construct ref and alt sequences
3. Scan with all relevant TF PWMs
4. Report TFs whose binding is created or destroyed by the SNP

### Workflow 3: Motif Enrichment Analysis

1. Identify a set of peak sequences (e.g., from ChIP-seq or ATAC-seq)
2. Scan all peaks with JASPAR PWMs
3. Compare hit rates in peaks vs. background sequences
4. Report significantly enriched motifs (Fisher's exact test or FIMO-style scoring)

## Collections Available

| Collection | Description | Profiles |
|------------|-------------|----------|
| `CORE` | Non-redundant, high-quality profiles | ~1,210 |
| `UNVALIDATED` | Experimentally derived but not validated | ~500 |
| `PHYLOFACTS` | Phylogenetically conserved sites | ~50 |
| `CNE` | Conserved non-coding elements | ~30 |
| `POLII` | RNA Pol II binding profiles | ~20 |
| `FAM` | TF family representative profiles | ~170 |
| `SPLICE` | Splice factor profiles | ~20 |

## Best Practices

- **Use CORE collection** for most analyses — best validated and non-redundant
- **Threshold selection**: 80% of max score is common for de novo prediction; 90% for high-confidence
- **Always scan both strands** — TFs can bind in either orientation
- **Provide flanking context** for variant analysis: at least (motif_length - 1) bp on each side
- **Consider background**: PWM scores relative to uniform (0.25) background; adjust for actual GC content
- **Cross-validate with ChIP-seq data** when available — motif scanning has many false positives
- **Use Biopython's motifs module** for full-featured scanning: `from Bio import motifs`

## Additional Resources

- **JASPAR portal**: https://jaspar.elixir.no/
- **API documentation**: https://jaspar.elixir.no/api/v1/docs/
- **JASPAR 2024 paper**: Castro-Mondragon et al. (2022) Nucleic Acids Research. PMID: 34875674
- **Biopython motifs**: https://biopython.org/docs/latest/Tutorial/chapter_motifs.html
- **FIMO tool** (for large-scale scanning): https://meme-suite.org/meme/tools/fimo
- **HOMER** (motif enrichment): http://homer.ucsd.edu/homer/
- **GitHub**: https://github.com/wassermanlab/JASPAR-UCSC-tracks

Get new playbooks like this one

One email a week with new Claude Code workflows. Free, like everything here.

No spam. Unsubscribe anytime.

README.md

What This Does

JASPAR (https://jaspar.elixir.no/) is the gold-standard open-access database of curated, non-redundant transcription factor (TF) binding profiles stored as position frequency matrices (PFMs). JASPAR 2024 contains 1,210 non-redundant TF binding profiles for 164 eukaryotic species. Each profile is experimentally derived (ChIP-seq, SELEX, HT-SELEX, protein binding microarray, etc.) and rigorously validated.

Key resources:


Quick Start

Step 1: Create a Project Folder

mkdir -p ~/Projects/jaspar-database

Step 2: Download the Template

Click Download above, then:

mv ~/Downloads/CLAUDE.md ~/Projects/jaspar-database/

Step 3: Start Claude Code

cd ~/Projects/jaspar-database
claude

Core Capabilities

1. JASPAR REST API

Base URL: https://jaspar.elixir.no/api/v1/

import requests

BASE_URL = "https://jaspar.elixir.no/api/v1"

def jaspar_get(endpoint, params=None):
    url = f"{BASE_URL}/{endpoint}"
    response = requests.get(url, params=params, headers={"Accept": "application/json"})
    response.raise_for_status()
    return response.json()

2. Search for TF Profiles

def search_jaspar(
    tf_name=None,
    species=None,
    collection="CORE",
    tf_class=None,
    tf_family=None,
    page=1,
    page_size=25
):
    """Search JASPAR for TF binding profiles."""
    params = {
        "collection": collection,
        "page": page,
        "page_size": page_size,
        "format": "json"
    }
    if tf_name:
        params["name"] = tf_name
    if species:
        params["species"] = species  # Use taxonomy ID or name, e.g., "9606" for human
    if tf_class:
        params["tf_class"] = tf_class
    if tf_family:
        params["tf_family"] = tf_family

    return jaspar_get("matrix", params)

# Examples:
# Search for human CTCF profile
ctcf = search_jaspar("CTCF", species="9606")
print(f"Found {ctcf['count']} CTCF profiles")

# Search for all homeobox TFs in human
hox_tfs = search_jaspar(tf_class="Homeodomain", species="9606")

# Search for a TF family
nfkb = search_jaspar(tf_family="NF-kappaB")

3. Fetch a Specific Matrix (PFM/PWM)

def get_matrix(matrix_id):
    """Fetch a specific JASPAR matrix by ID (e.g., 'MA0139.1' for CTCF)."""
    return jaspar_get(f"matrix/{matrix_id}/")

# Example: Get CTCF matrix
ctcf_matrix = get_matrix("MA0139.1")

# Matrix structure:
# {
#   "matrix_id": "MA0139.1",
#   "name": "CTCF",
#   "collection": "CORE",
#   "tax_group": "vertebrates",
#   "pfm": { "A": [...], "C": [...], "G": [...], "T": [...] },
#   "consensus": "CCGCGNGGNGGCAG",
#   "length": 19,
#   "species": [{"tax_id": 9606, "name": "Homo sapiens"}],
#   "class": ["C2H2 zinc finger factors"],
#   "family": ["BEN domain factors"],
#   "type": "ChIP-seq",
#   "uniprot_ids": ["P49711"]
# }

4. Download PFM/PWM as Matrix

import numpy as np

def get_pwm(matrix_id, pseudocount=0.8):
    """
    Fetch a PFM from JASPAR and convert to PWM (log-odds).
    Returns numpy array of shape (4, L) in order A, C, G, T.
    """
    matrix = get_matrix(matrix_id)
    pfm = matrix["pfm"]

    # Convert PFM to numpy
    pfm_array = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float)

    # Add pseudocount
    pfm_array += pseudocount

    # Normalize to get PPM
    ppm = pfm_array / pfm_array.sum(axis=0, keepdims=True)

    # Convert to PWM (log-odds relative to background 0.25)
    background = 0.25
    pwm = np.log2(ppm / background)

    return pwm, matrix["name"]

# Example
pwm, name = get_pwm("MA0139.1")  # CTCF
print(f"PWM for {name}: shape {pwm.shape}")
max_score = pwm.max(axis=0).sum()
print(f"Maximum possible score: {max_score:.2f} bits")

5. Scan a DNA Sequence for TF Binding Sites

import numpy as np
from typing import List, Tuple

NUCLEOTIDE_MAP = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
                  'a': 0, 'c': 1, 'g': 2, 't': 3}

def scan_sequence(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8) -> List[dict]:
    """
    Scan a DNA sequence for TF binding sites using a PWM.

    Args:
        sequence: DNA sequence string
        pwm: PWM array (4 x L) in ACGT order
        threshold_pct: Fraction of max score to use as threshold (0-1)

    Returns:
        List of hits with position, score, and matched sequence
    """
    motif_len = pwm.shape[1]
    max_score = pwm.max(axis=0).sum()
    min_score = pwm.min(axis=0).sum()
    threshold = min_score + threshold_pct * (max_score - min_score)

    hits = []
    seq = sequence.upper()

    for i in range(len(seq) - motif_len + 1):
        subseq = seq[i:i + motif_len]
        # Skip if contains non-ACGT
        if any(c not in NUCLEOTIDE_MAP for c in subseq):
            continue

        score = sum(pwm[NUCLEOTIDE_MAP[c], j] for j, c in enumerate(subseq))

        if score >= threshold:
            relative_score = (score - min_score) / (max_score - min_score)
            hits.append({
                "position": i + 1,  # 1-based
                "score": score,
                "relative_score": relative_score,
                "sequence": subseq,
                "strand": "+"
            })

    return hits

# Example: Scan a promoter sequence for CTCF binding sites
promoter = "AGCCCGCGAGGNGGCAGTTGCCTGGAGCAGGATCAGCAGATC"
pwm, name = get_pwm("MA0139.1")
hits = scan_sequence(promoter, pwm, threshold_pct=0.75)
for hit in hits:
    print(f"  Position {hit['position']}: {hit['sequence']} (score: {hit['score']:.2f}, {hit['relative_score']:.0%})")

6. Scan Both Strands

def reverse_complement(seq: str) -> str:
    complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'N': 'N'}
    return ''.join(complement.get(b, 'N') for b in reversed(seq.upper()))

def scan_both_strands(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8):
    """Scan forward and reverse complement strands."""
    fwd_hits = scan_sequence(sequence, pwm, threshold_pct)
    for h in fwd_hits:
        h["strand"] = "+"

    rev_seq = reverse_complement(sequence)
    rev_hits = scan_sequence(rev_seq, pwm, threshold_pct)
    seq_len = len(sequence)
    for h in rev_hits:
        h["strand"] = "-"
        h["position"] = seq_len - h["position"] - len(h["sequence"]) + 2  # Convert to fwd coords

    all_hits = fwd_hits + rev_hits
    return sorted(all_hits, key=lambda x: x["position"])

7. Variant Impact on TF Binding

def variant_tfbs_impact(ref_seq: str, alt_seq: str, pwm: np.ndarray,
                          tf_name: str, threshold_pct: float = 0.7):
    """
    Assess impact of a SNP on TF binding by comparing ref vs alt sequences.
    Both sequences should be centered on the variant with flanking context.
    """
    ref_hits = scan_both_strands(ref_seq, pwm, threshold_pct)
    alt_hits = scan_both_strands(alt_seq, pwm, threshold_pct)

    max_ref = max((h["score"] for h in ref_hits), default=None)
    max_alt = max((h["score"] for h in alt_hits), default=None)

    result = {
        "tf": tf_name,
        "ref_max_score": max_ref,
        "alt_max_score": max_alt,
        "ref_has_site": len(ref_hits) > 0,
        "alt_has_site": len(alt_hits) > 0,
    }
    if max_ref and max_alt:
        result["score_change"] = max_alt - max_ref
        result["effect"] = "gained" if max_alt > max_ref else "disrupted"
    elif max_ref and not max_alt:
        result["effect"] = "disrupted"
    elif not max_ref and max_alt:
        result["effect"] = "gained"
    else:
        result["effect"] = "no_site"

    return result

Query Workflows

Workflow 1: Find All TF Binding Sites in a Promoter

import requests, numpy as np

# 1. Get relevant TF matrices (e.g., all human TFs in CORE collection)
response = requests.get(
    "https://jaspar.elixir.no/api/v1/matrix/",
    params={"species": "9606", "collection": "CORE", "page_size": 500, "page": 1}
)
matrices = response.json()["results"]

# 2. For each matrix, compute PWM and scan promoter
promoter = "CCCGCCCGCCCGCCGCCCGCAGTTAATGAGCCCAGCGTGCC"  # Example

all_hits = []
for m in matrices[:10]:  # Limit for demo
    pwm_data = requests.get(f"https://jaspar.elixir.no/api/v1/matrix/{m['matrix_id']}/").json()
    pfm = pfm_data["pfm"]
    pfm_arr = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float) + 0.8
    ppm = pfm_arr / pfm_arr.sum(axis=0)
    pwm = np.log2(ppm / 0.25)

    hits = scan_sequence(promoter, pwm, threshold_pct=0.8)
    for h in hits:
        h["tf_name"] = m["name"]
        h["matrix_id"] = m["matrix_id"]
    all_hits.extend(hits)

print(f"Found {len(all_hits)} TF binding sites")
for h in sorted(all_hits, key=lambda x: -x["score"])[:5]:
    print(f"  {h['tf_name']} ({h['matrix_id']}): pos {h['position']}, score {h['score']:.2f}")

Workflow 2: SNP Impact on TF Binding (Regulatory Variant Analysis)

  1. Retrieve the genomic sequence flanking the SNP (±20 bp each side)
  2. Construct ref and alt sequences
  3. Scan with all relevant TF PWMs
  4. Report TFs whose binding is created or destroyed by the SNP

Workflow 3: Motif Enrichment Analysis

  1. Identify a set of peak sequences (e.g., from ChIP-seq or ATAC-seq)
  2. Scan all peaks with JASPAR PWMs
  3. Compare hit rates in peaks vs. background sequences
  4. Report significantly enriched motifs (Fisher's exact test or FIMO-style scoring)

Collections Available

Collection Description Profiles
CORE Non-redundant, high-quality profiles ~1,210
UNVALIDATED Experimentally derived but not validated ~500
PHYLOFACTS Phylogenetically conserved sites ~50
CNE Conserved non-coding elements ~30
POLII RNA Pol II binding profiles ~20
FAM TF family representative profiles ~170
SPLICE Splice factor profiles ~20

Best Practices

  • Use CORE collection for most analyses — best validated and non-redundant
  • Threshold selection: 80% of max score is common for de novo prediction; 90% for high-confidence
  • Always scan both strands — TFs can bind in either orientation
  • Provide flanking context for variant analysis: at least (motif_length - 1) bp on each side
  • Consider background: PWM scores relative to uniform (0.25) background; adjust for actual GC content
  • Cross-validate with ChIP-seq data when available — motif scanning has many false positives
  • Use Biopython's motifs module for full-featured scanning: from Bio import motifs

Additional Resources

$Related Playbooks

Academic Research

Scientific Kegg Database

Direct REST API access to KEGG (academic use only). Pathway analysis, gene-pathway mapping, metabolic pathways, drug interactions, ID conversion. For Python workflows with multiple databases, prefer bioservices. Use this for direct HTTP/REST work ...

5 minutes
Beginner
Academic Research

Scientific Labarchive Integration

Electronic lab notebook API integration. Access notebooks, manage entries/attachments, backup notebooks, integrate with Protocols.io/Jupyter/REDCap, for programmatic ELN workflows.

10 minutes
Intermediate
Academic Research

Scientific Lamindb

This skill should be used when working with LaminDB, an open-source data framework for biology that makes data queryable, traceable, reproducible, and FAIR. Use when managing biological datasets (scRNA-seq, spatial, flow cytometry, etc.), tracking...

15 minutes
Advanced
Academic Research

Scientific Latchbio Integration

Latch platform for bioinformatics workflows. Build pipelines with Latch SDK, @workflow/@task decorators, deploy serverless workflows, LatchFile/LatchDir, Nextflow/Snakemake integration.

10 minutes
Intermediate
Academic Research

Scientific Matchms

Spectral similarity and compound identification for metabolomics. Use for comparing mass spectra, computing similarity scores (cosine, modified cosine), and identifying unknown compounds from spectral libraries. Best for metabolite identification,...

10 minutes
Intermediate
Academic Research

Scientific Medchem

Medicinal chemistry filters. Apply drug-likeness rules (Lipinski, Veber), PAINS filters, structural alerts, complexity metrics, for compound prioritization and library filtering.

10 minutes
Intermediate
Academic Research

Scientific Metabolomics Workbench Database

Access NIH Metabolomics Workbench via REST API (4,200+ studies). Query metabolites, RefMet nomenclature, MS/NMR data, m/z searches, study metadata, for metabolomics and biomarker discovery.

5 minutes
Beginner
Academic Research

Scientific Molecular Dynamics

Run and analyze molecular dynamics simulations with OpenMM and MDAnalysis. Set up protein/small molecule systems, define force fields, run energy minimization and production MD, analyze trajectories (RMSD, RMSF, contact maps, free energy surfaces)...

15 minutes
Advanced
Academic Research

Scientific Molfeat

Molecular featurization for ML (100+ featurizers). ECFP, MACCS, descriptors, pretrained models (ChemBERTa), convert SMILES to features, for QSAR and molecular ML.

10 minutes
Intermediate
Academic Research

Scientific Monarch Database

Query the Monarch Initiative knowledge graph for disease-gene-phenotype associations across species. Integrates OMIM, ORPHANET, HPO, ClinVar, and model organism databases. Use for rare disease gene discovery, phenotype-to-gene mapping, cross-speci...

5 minutes
Beginner
Academic Research

Scientific Neurokit2

Comprehensive biosignal processing toolkit for analyzing physiological data including ECG, EEG, EDA, RSP, PPG, EMG, and EOG signals. Use this skill when processing cardiovascular signals, brain activity, electrodermal responses, respiratory patter...

10 minutes
Intermediate
Academic Research

Scientific Neuropixels Analysis

Neuropixels neural recording analysis. Load SpikeGLX/OpenEphys data, preprocess, motion correction, Kilosort4 spike sorting, quality metrics, Allen/IBL curation, AI-assisted visual analysis, for Neuropixels 1.0/2.0 extracellular electrophysiology....

15 minutes
Advanced

Browse all Academic Research playbooks →